View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793_low_23 (Length: 258)
Name: NF4793_low_23
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 10327763 - 10327815
Alignment:
| Q |
6 |
gagatgcaatgttagctgggaatgaagcgaaggaagaaggtgaaggtggtggt |
58 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10327763 |
gagatgaaatgttagctgggaatgaagcgaaggaagaaggtgaaggtggtggt |
10327815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 243
Target Start/End: Original strand, 10327945 - 10327985
Alignment:
| Q |
203 |
agattgttgttttgtggaaaaggttgatgaaggaatcttct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10327945 |
agattgttgttttgtggaaaaggttgatgaaggaatcttct |
10327985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University