View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4793_low_23 (Length: 258)

Name: NF4793_low_23
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4793_low_23
NF4793_low_23
[»] chr8 (2 HSPs)
chr8 (6-58)||(10327763-10327815)
chr8 (203-243)||(10327945-10327985)


Alignment Details
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 58
Target Start/End: Original strand, 10327763 - 10327815
Alignment:
6 gagatgcaatgttagctgggaatgaagcgaaggaagaaggtgaaggtggtggt 58  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
10327763 gagatgaaatgttagctgggaatgaagcgaaggaagaaggtgaaggtggtggt 10327815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 203 - 243
Target Start/End: Original strand, 10327945 - 10327985
Alignment:
203 agattgttgttttgtggaaaaggttgatgaaggaatcttct 243  Q
    |||||||||||||||||||||||||||||||||||||||||    
10327945 agattgttgttttgtggaaaaggttgatgaaggaatcttct 10327985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University