View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793_low_30 (Length: 238)
Name: NF4793_low_30
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 99 - 222
Target Start/End: Complemental strand, 45121695 - 45121572
Alignment:
| Q |
99 |
agatatcacaaagttttatatcatcattaaacacttcaattgaaccaaaaatctgcacaacttttgacttttcttgaccaatgaatactgaaaatatctc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45121695 |
agatatcacaaagttttatatcatcattaaacacttcaattgaaccaaaaatctgcacaacttttgacttttcttgaccaatgaatactgaaaatatctc |
45121596 |
T |
 |
| Q |
199 |
aacaacagtagatgaccatggttt |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45121595 |
aacaacagtagatgaccatggttt |
45121572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 45121758 - 45121691
Alignment:
| Q |
1 |
cagtgatctacaatcttcaaaaacccgagagccatccgatataggtatgaatttcaaattttcagata |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45121758 |
cagtgatctacaatcttcaaaaacccgagagccatccgatataggtatgaatttcaaattttcagata |
45121691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University