View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4793_low_33 (Length: 235)
Name: NF4793_low_33
Description: NF4793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4793_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 34 - 217
Target Start/End: Original strand, 32227490 - 32227672
Alignment:
| Q |
34 |
gttctttttgtggttgtcatgacaatgggaggaattgtgtagaataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaactaaggttgg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32227490 |
gttctttttgtggttgtcatgacaatgggaggaattgtgtagaataaaagagtagtcagtggacatgtttttgtgttcctctctcttgaac-aaggttgg |
32227588 |
T |
|
| Q |
134 |
gactgctctacgatgtattgtttataatttttggtggataacatctacataaattatcttgaatgtttcagtatagatcgtttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32227589 |
gactgctctacgatgtattgtttataatttttggtggataacatctacataaattatcttgaatgttccagtatagatcgtttg |
32227672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University