View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4794_high_2 (Length: 299)
Name: NF4794_high_2
Description: NF4794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4794_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 4159822 - 4159653
Alignment:
| Q |
20 |
tatggctgaatatttacttataacctaacatctgactaatattcaaaaattactgtgtagaccttatagtgcacctgagatgtgattatatgaaaattga |
119 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||||||| |||||| ||||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
4159822 |
tatggctgaatatttagttataacctgaaatctgactaatattcataaattagtgtgtaggccttataatgcacctgagatatgattatatgaaaattga |
4159723 |
T |
|
| Q |
120 |
tgtgattaatttttgtagaaacttgatgtatctgcataatatgaaaggtatcgtttactctatcaaattc |
189 |
Q |
| |
|
||||||||| |||| | |||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4159722 |
tgtgattaagttttatggaaaattgatgtatctgcataatatgaaaggtattgtttactctatcaaattc |
4159653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University