View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795-Insertion-15 (Length: 311)
Name: NF4795-Insertion-15
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795-Insertion-15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 7 - 311
Target Start/End: Original strand, 41859770 - 41860074
Alignment:
| Q |
7 |
atccacaaggtctaaggagaaaaatggacaggggtatgggaaaagctattgaaattgcttccacgtttgtgaaagagcgtttggatttggaagtggaacg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41859770 |
atccacaaggtctaaggagaaaaatggacagggatatgggaaaagctattgaaattgcttccacgtttgtgaaagagcgtttggatttggaagtggaacg |
41859869 |
T |
|
| Q |
107 |
tgatgagaaatcaagagatttcttggatgtcttgcttgagttccaaagaaatgagaatcaagatgcagtcaacatctcagataaagatctcaacgttttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41859870 |
tgatgagaaatcaagagatttcttggatgtcttgcttgagttccaaagaaatgagaatcaagatgcagtcaacatctcagataaagatctcaacgttttc |
41859969 |
T |
|
| Q |
207 |
atcttggtaagtaatttcctccctaaatatagacaattacttatccctttttatataatatatttttctaatccaccatgtttaaaatctttgataggga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | | |
|
|
| T |
41859970 |
atcttggtaagtaatttcctccctaaatatagacaattacttatccctttttatataatatatttttctaatccaccatggttaaaatctttgatacgaa |
41860069 |
T |
|
| Q |
307 |
aatga |
311 |
Q |
| |
|
||||| |
|
|
| T |
41860070 |
aatga |
41860074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University