View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795-Insertion-16 (Length: 126)
Name: NF4795-Insertion-16
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795-Insertion-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 7e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 7e-59
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 32539455 - 32539573
Alignment:
| Q |
8 |
aataaaagagcttaagataaaaagtttgaggaattcaattgagcttttaaccataattgcagaattaaattccaatagtttacaagttgcaacaacatgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539455 |
aataaaagagcttaagataaaaagtttgaggaattcaattgagcttttaaccataattgcagaattaaattccaatagtttacaagttgcaacaacatgc |
32539554 |
T |
|
| Q |
108 |
ggaataccaaattctcatc |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32539555 |
ggaataccaaattctcatc |
32539573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University