View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795_high_7 (Length: 218)
Name: NF4795_high_7
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 41779218 - 41779031
Alignment:
| Q |
18 |
ctctaacccatgcagcaacgccaaatcgaatttctaatgcatcaaggactttgaagnnnnnnntaataatattgtatagcgatattactcatgagatgat |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41779218 |
ctctaacccattcagcaacgccaaatcgaatttctaaagcatcaaggactttgaagaagaaaa-aataatattgtacagcgatattactcatgagatgat |
41779120 |
T |
|
| Q |
118 |
atgatgttttagttactttgtttcacgtaaaaatccacttggattgatctagtagtcttaatttgagaccgtggagtgtgtttcttctc |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41779119 |
atgatgttttggttactttgtttcacgtaaaaatccatttggattgatctggtagtcttagtttgagaccgtggagtgtgtttcttctc |
41779031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University