View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795_high_9 (Length: 207)
Name: NF4795_high_9
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 26 - 191
Target Start/End: Complemental strand, 7118446 - 7118281
Alignment:
| Q |
26 |
gtattgggactgtagtttttagtgtatgtggctgatgtgagcatctatcagatttggggctggctactactatcctacttttcttgtttttccaatagct |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7118446 |
gtattgggactgtagtttttagtgtatgtggctgatgtgagtatctatcagatttggggttggctactactatcctacttttctggtttttccaatagct |
7118347 |
T |
|
| Q |
126 |
gcctttgcaattttgttggttcatcaataaaacaaaactgtcacgaatgattcatgaattatatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7118346 |
gcctttgcaattttgttggttcatcaataaaacaaaactgtcacgaatgattcatgaattatatat |
7118281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 26 - 191
Target Start/End: Complemental strand, 7130924 - 7130759
Alignment:
| Q |
26 |
gtattgggactgtagtttttagtgtatgtggctgatgtgagcatctatcagatttggggctggctactactatcctacttttcttgtttttccaatagct |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7130924 |
gtattgggactgtagtttttagtgtatgtggctgatgtgagtatctatcagatttggggttggctactactatcctacttttctggtttttccaatagct |
7130825 |
T |
|
| Q |
126 |
gcctttgcaattttgttggttcatcaataaaacaaaactgtcacgaatgattcatgaattatatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7130824 |
gcctttgcaattttgttggttcatcaataaaacaaaactgtcgcgaatgattcatgaattatatat |
7130759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 23 - 66
Target Start/End: Complemental strand, 10613126 - 10613083
Alignment:
| Q |
23 |
ctggtattgggactgtagtttttagtgtatgtggctgatgtgag |
66 |
Q |
| |
|
|||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10613126 |
ctggtagtgggactatagtctttagtgtatgtggctgatgtgag |
10613083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University