View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795_low_3 (Length: 390)
Name: NF4795_low_3
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 31658808 - 31658583
Alignment:
| Q |
18 |
ctaaggaagagattcatgatgattattcttctcaaaatcaattgttctcatcagataacctcatatcatgtaactttgaattttgttttgattatttgag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31658808 |
ctaaggaagagattcatgatgattattcttctcaaaatcaattgttctcatcagataacctcatatcatgtaactttgaagtttattttgattatttgag |
31658709 |
T |
|
| Q |
118 |
acatgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgta |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658708 |
acgtgccactatgctatcatcgattgaatcatttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgta |
31658609 |
T |
|
| Q |
218 |
aatttattttcaaagtttggcattgg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31658608 |
aatttattttcaaagtttggcattgg |
31658583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 345 - 382
Target Start/End: Complemental strand, 31658558 - 31658521
Alignment:
| Q |
345 |
taatgggagatttatttgatcgtttaactgatgatgtc |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtc |
31658521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University