View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4795_low_7 (Length: 233)
Name: NF4795_low_7
Description: NF4795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4795_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 42750413 - 42750207
Alignment:
| Q |
17 |
caccaataccatgagctgccatctaaggaggacttcattaaagcccctaagattcatgaaccctattcccccgtcagattttggcttgcataagtgatcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42750413 |
caccaataccatgagctgccatctaaggaggacttcattaaagcccctaagattcatgaaccctatttccccgtcagattttggcttgcataagtgatcc |
42750314 |
T |
|
| Q |
117 |
ctcataatccaatgaactttaccctcaaagtctttactctcccaccaaaaagaacttaagatgtttaatctacgaagtaagacatatgtaagtcttattc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42750313 |
ctcataatccaatgaactttaccctcaaagtctttactctcccaccaaaaagaacttaagatgtttaatctacgaattaagacatatgtaagtcttattc |
42750214 |
T |
|
| Q |
217 |
atctcac |
223 |
Q |
| |
|
|| |||| |
|
|
| T |
42750213 |
atttcac |
42750207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 62 - 166
Target Start/End: Complemental strand, 42759475 - 42759371
Alignment:
| Q |
62 |
cctaagattcatgaaccctattcccccgtcagattttggcttgcataagtgatccctcataatccaatgaactttaccctcaaagtctttactctcccac |
161 |
Q |
| |
|
|||||| ||||| ||||||||| |||| ||| |||| ||||||||||| |||| || ||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
42759475 |
cctaagtttcataaaccctatttccccatcatatttgggcttgcataaatgattccacataatccaataaactttagtctcaaagtctttactctcccac |
42759376 |
T |
|
| Q |
162 |
caaaa |
166 |
Q |
| |
|
||||| |
|
|
| T |
42759375 |
caaaa |
42759371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University