View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4796_low_3 (Length: 273)
Name: NF4796_low_3
Description: NF4796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4796_low_3 |
 | |
|
| [»] scaffold0115 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0115 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: scaffold0115
Description:
Target: scaffold0115; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 45583 - 45848
Alignment:
| Q |
1 |
cagaggacccaaagtaccttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgttt |
100 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45583 |
cagatgacccaaaggaacttggtaagtgcgttataaaatccatagatagatctatccacacttgttgagggattggtaatggtttgagtaacccctgttt |
45682 |
T |
|
| Q |
101 |
tttggttggcatgtacttactcttatggaaaatttcgcacctaaggacccagtgtttgatatctttataggcatatggttaaagaaacgatgcggccatt |
200 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||||| |||||||| ||||| | |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
45683 |
cttggttggcatttacttactcttctgaaaaatttcgcacctgaggacccaatgtttcacatctttataggcatctggtcaaagaaacgatgcggccatt |
45782 |
T |
|
| Q |
201 |
ctggatagagttggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
266 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45783 |
ctggctagagttggctggagactggagtgtcctgaaagaggtgtgtcatgaaactctttgatgatg |
45848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University