View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4798-Insertion-10 (Length: 195)
Name: NF4798-Insertion-10
Description: NF4798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4798-Insertion-10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 8 - 195
Target Start/End: Complemental strand, 48417667 - 48417480
Alignment:
| Q |
8 |
gtctgttcatgcaatatgtagttgtgtataccatgaagcatatcactgttgcattgatgaaaaattttaatggcagttatgttattgttgaatgtctaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48417667 |
gtctgttcatgcaatatgtagttgtgtataccatgaagcatatcactgttgcattgatgaaaaattttaatggcagttatgttattgttgaatgtctaaa |
48417568 |
T |
 |
| Q |
108 |
gctttttccacccgaacaccaaaatgtaagtaatgctgcgtccctatttttcatgcattaaaattcttatatttaactagaatgatta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48417567 |
gctttttccacccgaacaccaaaatgtaagtaatgctgcgtccctatttttcatgcattaaaattcttatatttaactagaatgatta |
48417480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University