View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4799-Insertion-3 (Length: 138)
Name: NF4799-Insertion-3
Description: NF4799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4799-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 5e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 28858826 - 28858717
Alignment:
| Q |
7 |
acattgttgataaagaagtgatcataaaaagtagcaaattatagagatgagttttaatgttgagagggaagatcttgatcttgcaagtttggtggaaatt |
106 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28858826 |
acattgttgataaagaagtggtcataaaaaggagcaaattatagagatgagttttaatgttgagagggaagatcttgatcttgcaagtttggtggaaatt |
28858727 |
T |
|
| Q |
107 |
gtattttctt |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
28858726 |
gtattttctt |
28858717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 10 - 65
Target Start/End: Complemental strand, 28860861 - 28860806
Alignment:
| Q |
10 |
ttgttgataaagaagtgatcataaaaagtagcaaattatagagatgagttttaatg |
65 |
Q |
| |
|
||||||| |||||||| |||||||||||||| || || |||||||||||||||| |
|
|
| T |
28860861 |
ttgttgagaaagaagttgtcataaaaagtagccaagtacggagatgagttttaatg |
28860806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University