View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4799_high_18 (Length: 316)
Name: NF4799_high_18
Description: NF4799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4799_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 2 - 306
Target Start/End: Original strand, 39966399 - 39966703
Alignment:
| Q |
2 |
ctaacagggttgaatctcctcatgggaggttgaagaaatgttttaaggatagtaaagggaaattggttaaagattggaatgcgatgaacaatctattata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39966399 |
ctaacagggttgaatctcctcatgggaggttgaagaaatgttttaaggatagtaaaggaaaattggttaaagattgaaatgcgatgaacaatctattata |
39966498 |
T |
|
| Q |
102 |
gttgcagttcattaatgagatgtgtttattaatgcattcatgtatcgaaaaaattgtggattatgagttcactattgttgatcatgagttgtagctgaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39966499 |
gttgcagttcattaatgagatgtgtttattcatgcattcatgtattgaaaatattgtggattatgagttcactattgttgatcatgagttgtagctgaac |
39966598 |
T |
|
| Q |
202 |
atctcaagggtgaagatagttagtccataattcgttgtgcacttcttaaagacattttgatacaacatatgcgtttgaatgaagaagggaacatatgtgt |
301 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39966599 |
atctcaacggtgaagatagttagtccataattcgttgtgcacttcttaaagacattttgatacaacatatgcgttcgaatgaagaagggaacatatgtgt |
39966698 |
T |
|
| Q |
302 |
ctgtg |
306 |
Q |
| |
|
|||| |
|
|
| T |
39966699 |
ttgtg |
39966703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University