View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4799_high_8 (Length: 341)
Name: NF4799_high_8
Description: NF4799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4799_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 6 - 341
Target Start/End: Original strand, 53927576 - 53927912
Alignment:
| Q |
6 |
agcaccacagatt-acggagtttggacaaactgctattgttctgcgatgcaattagtacaaattgttttcaaattgtgcctacactggtgctgtagcata |
104 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53927576 |
agcaccacagattgacggagtttggacaaactgctattgttctgcgatgcaattagtacaaattgttttcaaattgtgccttcactggtgctgtagcata |
53927675 |
T |
 |
| Q |
105 |
gtggaattcaaacaaacccctattctctgcgatttgcctttgaaaacattgatctggcacacaatcttctgctaattgtctaaaactgtaacttttgttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53927676 |
gtggaattcaaacaaacccctattctctgcgatttgcctttgaaaacattgatctggcacacaatcttctgctaattgtctaaaactgtaacttttgttg |
53927775 |
T |
 |
| Q |
205 |
ttttgggtatgaatagcgccatgtttctttcgtttacggtgagggaaacttcttttacttactttacagtttatatcatcaacagactgcattgatgcaa |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
53927776 |
ttttgggtatgaatagcgccatgtttctttcgtttacggagagggaaacttcttttacttactttacagttaatatcattaacagactgcattgatgcaa |
53927875 |
T |
 |
| Q |
305 |
gcctgccaacatggtcattgggaggtggttcagaccc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53927876 |
gcctgccaacatggtcattgggaggtggttcagaccc |
53927912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University