View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4800-Insertion-10 (Length: 270)
Name: NF4800-Insertion-10
Description: NF4800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4800-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 42761037 - 42761156
Alignment:
| Q |
7 |
aaggttttggtaggaaaatcggttcatgggtcggtgtttaggtgtggtttggatcaggatttgtttgtgggtactactttggttgatatgtatggtaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42761037 |
aaggttttggtaggaaaatcggttcatgggtcggtgtttaggtgtggtttggatcaggatttgtttgtgggtactactttggttgatatgtatggtaaat |
42761136 |
T |
|
| Q |
107 |
gcggggagattggtgatgct |
126 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
42761137 |
gcggtgagattggtgatgct |
42761156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 143 - 270
Target Start/End: Original strand, 42804853 - 42804980
Alignment:
| Q |
143 |
atataagtttattgccgtttttcactaactgtcgcatataattttaacatgaaagaacatgagaggatccattctcattgaagttaagttatgctttcat |
242 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
42804853 |
atataagtttattgccatttttcactaactgtcgcatataatttcaacatgaaagaacatgagaggatctattctcattgaagttaagttatgctttctt |
42804952 |
T |
|
| Q |
243 |
ctatgttactttggattgaggttttaat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42804953 |
ctatgttactttggattgaggttttaat |
42804980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 143 - 270
Target Start/End: Original strand, 42762451 - 42762578
Alignment:
| Q |
143 |
atataagtttattgccgtttttcactaactgtcgcatataattttaacatgaaagaacatgagaggatccattctcattgaagttaagttatgctttcat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||| | |
|
|
| T |
42762451 |
atataagtttattgccgtttttcactaactgtcacatataattttaacatgaaagagcatgagaggatccattctcattgaagtgaatttatgctttctt |
42762550 |
T |
|
| Q |
243 |
ctatgttactttggattgaggttttaat |
270 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
42762551 |
ctatgttactttggattgaagttttaat |
42762578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 126
Target Start/End: Original strand, 42803439 - 42803558
Alignment:
| Q |
7 |
aaggttttggtaggaaaatcggttcatgggtcggtgtttaggtgtggtttggatcaggatttgtttgtgggtactactttggttgatatgtatggtaaat |
106 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
42803439 |
aaggttttggtaggaaagtcggttcacgggtcggtgtttaggtgtggtttggatcaggatttgtttatgggtactactttgattgatatgtatggtaaat |
42803538 |
T |
|
| Q |
107 |
gcggggagattggtgatgct |
126 |
Q |
| |
|
| || ||||| |||||||| |
|
|
| T |
42803539 |
gtggacagattagtgatgct |
42803558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 147 - 270
Target Start/End: Original strand, 33048811 - 33048924
Alignment:
| Q |
147 |
aagtttattgccgtttttcactaactgtcgcatataattttaacatgaaagaacatgagaggatccattctcattgaagttaagttatgctttcatctat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33048811 |
aagtttattgccgtttttcactaactgtcgcatataattttaaca----------tgagaggatccattctcattgaagttaagttatgctttcttctat |
33048900 |
T |
|
| Q |
247 |
gttactttggattgaggttttaat |
270 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
33048901 |
gttacttaggattgaggttttaat |
33048924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 6170821 - 6170723
Alignment:
| Q |
9 |
ggttttggtaggaaaatcggttcatgggtcggtgtttaggtgtggtttggatcaggatttgtttgtgggtactactttggttgatatgtatggtaaatg |
107 |
Q |
| |
|
|||| |||| ||||||| |||||||| |||||| || | ||||||||||||||||||| |||||||||| |||| |||| || |||||||||||||||| |
|
|
| T |
6170821 |
ggttatggttggaaaattggttcatgagtcggttttgaagtgtggtttggatcaggatgtgtttgtgggaactagtttgatttatatgtatggtaaatg |
6170723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 6250183 - 6250085
Alignment:
| Q |
9 |
ggttttggtaggaaaatcggttcatgggtcggtgtttaggtgtggtttggatcaggatttgtttgtgggtactactttggttgatatgtatggtaaatg |
107 |
Q |
| |
|
|||| |||| ||||||| |||||||| |||||| || | ||||||||| ||||||||| |||||||||| |||| |||| || |||||||||||||||| |
|
|
| T |
6250183 |
ggttatggttggaaaattggttcatgagtcggttttgaagtgtggtttcgatcaggatgtgtttgtgggaactagtttgatttatatgtatggtaaatg |
6250085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University