View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4800-Insertion-5 (Length: 523)
Name: NF4800-Insertion-5
Description: NF4800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4800-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 5e-54; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 27 - 202
Target Start/End: Original strand, 14469872 - 14470046
Alignment:
| Q |
27 |
cttgatgatcacattgatttccttagatacttgctacaccaaacgtgttttcgtagaatccaagaaaaagcaaagtcggtacttaaccatgtagccaaga |
126 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
14469872 |
cttgatgatgacattgatctccttaaatgcttgctacaccaaacatgtttccgtagaatccaagaaaaagcaaagtcggtacttaaccatgt-gtcaaga |
14469970 |
T |
|
| Q |
127 |
aatcagaaagaccagagttgtggtattttactaccttcaaggccataacaaaatagtagaaatatacatgtattgt |
202 |
Q |
| |
|
| |||||| |||||||| |||||||||||| |||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
14469971 |
taacagaaatgccagagttttggtattttactgccttcaaggccagaacaaaatagtagaaatatgcatgtattgt |
14470046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 375 - 481
Target Start/End: Original strand, 14470223 - 14470330
Alignment:
| Q |
375 |
tagagaaagagcgtgcctaattgttctacaagttacaatacctccgtcatcaagaatgcaaccattgtcttttggtaacgtcagcgcttca-tgaacaat |
473 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
14470223 |
tagagaaagagcgtgactaattgttctacaagttacaataccttcggcatcaagaatgcaaccattgtcttttggtaacgtcaacgcttcaccgaacaat |
14470322 |
T |
|
| Q |
474 |
cccacttt |
481 |
Q |
| |
|
|||||||| |
|
|
| T |
14470323 |
cccacttt |
14470330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 241 - 289
Target Start/End: Original strand, 14470131 - 14470179
Alignment:
| Q |
241 |
aattggctcttttattaccttcatgatgtctctgcttgcttagatggag |
289 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| ||||||| |||||| |
|
|
| T |
14470131 |
aattggctcctttattaccttcatgatatctctgtttgcttatatggag |
14470179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 422 - 456
Target Start/End: Original strand, 2288583 - 2288617
Alignment:
| Q |
422 |
catcaagaatgcaaccattgtcttttggtaacgtc |
456 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2288583 |
catcaggaatgcaaccattgtcttttggtaacgtc |
2288617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 431 - 523
Target Start/End: Complemental strand, 1718365 - 1718272
Alignment:
| Q |
431 |
tgcaaccattgtcttttggtaacgtcagcgctt-catgaacaatcccactttaaatagtttatttattataatcataaccataataaatcggag |
523 |
Q |
| |
|
|||||||||||||||| | | |||||| |||| ||||||| ||||| ||||||||| | ||| |||||||||||||||||| |||||||| |
|
|
| T |
1718365 |
tgcaaccattgtctttcgatgacgtcaatgcttagttgaacaagcccacattaaatagtctctttggtataatcataaccataattaatcggag |
1718272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University