View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4800_high_8 (Length: 250)
Name: NF4800_high_8
Description: NF4800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4800_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 49027880 - 49027650
Alignment:
| Q |
15 |
ggcaataatttttccacagcataccctgttatacctatcttttccttggtttatctttctgtatcttggtgtnnnnnnntgtgaacaaaacattactcat |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49027880 |
ggcaataatttttccatagcataccctgtgatacctatcttttccttggtttatctttctgtatcttggtgtaaaaaaatgtgaacaaaacattactcat |
49027781 |
T |
 |
| Q |
115 |
ttatatatctatattggcgatgtaaaaatgaaaacgatgagtatttacatatacacgggcaaaatatgtagtacactagctttgctattgtctatgaact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49027780 |
ttatatatctatattggcgatgtaaaaatgaaaacgatgagtatttacatatacacgggcaaaatatgtagtacactagctttgctattgtctatgaact |
49027681 |
T |
 |
| Q |
215 |
caggcggcagcttcgctccacctttgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
49027680 |
caggcggcagcttcgctccacctttgtttct |
49027650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University