View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4800_low_10 (Length: 233)

Name: NF4800_low_10
Description: NF4800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4800_low_10
NF4800_low_10
[»] chr1 (1 HSPs)
chr1 (19-233)||(49028247-49028461)
[»] chr4 (1 HSPs)
chr4 (33-122)||(32803661-32803750)


Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 49028461 - 49028247
Alignment:
19 tttgctcccacggatgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatgga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49028461 tttgctcccacggatgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatgga 49028362  T
119 acgatctggtggattttggtgacggtacgcagttgccgacgtttttggaagggtttagtatcaatattacaagatccggtggcgttttgattcttaacgg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49028361 acgatctggtggattttggtgacggtacgcagttgccgacgtttttggaagggtttagtatcaatattacaagatccggtggcgttttgattcttaacgg 49028262  T
219 cgtgccgggattctt 233  Q
    |||||||| ||||||    
49028261 cgtgccggtattctt 49028247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 32803750 - 32803661
Alignment:
33 tgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatggaacga 122  Q
    |||||||| |||||| |  |||||||||||||||||| ||| ||   ||||||||||  |||||||||||| ||||||| | ||||||||    
32803750 tgagatggggatgaatcttatcggtgatttcgaagaccatcattggctctttcgtcgtgatgtggtgccttacaagtttatctggaacga 32803661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University