View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4800_low_10 (Length: 233)
Name: NF4800_low_10
Description: NF4800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4800_low_10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 49028461 - 49028247
Alignment:
| Q |
19 |
tttgctcccacggatgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49028461 |
tttgctcccacggatgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatgga |
49028362 |
T |
|
| Q |
119 |
acgatctggtggattttggtgacggtacgcagttgccgacgtttttggaagggtttagtatcaatattacaagatccggtggcgttttgattcttaacgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49028361 |
acgatctggtggattttggtgacggtacgcagttgccgacgtttttggaagggtttagtatcaatattacaagatccggtggcgttttgattcttaacgg |
49028262 |
T |
|
| Q |
219 |
cgtgccgggattctt |
233 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
49028261 |
cgtgccggtattctt |
49028247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 122
Target Start/End: Complemental strand, 32803750 - 32803661
Alignment:
| Q |
33 |
tgagatggtgatgaaccgcatcggtgatttcgaagactatccttcattctttcgtcgacatgtggtgccttgcaagtttctatggaacga |
122 |
Q |
| |
|
|||||||| |||||| | |||||||||||||||||| ||| || |||||||||| |||||||||||| ||||||| | |||||||| |
|
|
| T |
32803750 |
tgagatggggatgaatcttatcggtgatttcgaagaccatcattggctctttcgtcgtgatgtggtgccttacaagtttatctggaacga |
32803661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University