View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4801-Insertion-2 (Length: 503)
Name: NF4801-Insertion-2
Description: NF4801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4801-Insertion-2 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 154 - 503
Target Start/End: Complemental strand, 4093975 - 4093628
Alignment:
| Q |
154 |
ttttcatgcacagtacatggtatggaatatgcctttggagcacatgaatacccaactagtggtgtgtttgaggtggaacctaaaaattgccctggctttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093975 |
ttttcatgcacagtacatggtatggaatatggctttggagcacatgaatacccaactagtggtgtgtttgaggtggaacctaaaaattgccctggctttg |
4093876 |
T |
|
| Q |
254 |
tcttcagacgatcggtattgttaggcagcactgatatgtctctcacagaattccgctgtcttttatggaccgtatctctgcaaaatatcatggagacact |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4093875 |
tcttcagacgatcggtattgttaggcagcactgatatgtctctcacagaatttcgtt--cttttatggagcgtatctctgcaaaatatcatggagacact |
4093778 |
T |
|
| Q |
354 |
taccatctaattgccaaaaattgcaaccattttacgaatgaagtttgccaacaactaacaggaaatcctattcctggatgggtaaaccgacttgctcgtg |
453 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4093777 |
taccatctaattgccaaaaattgcaaccattttaccaatgaagtttgccaacaactaacaggaaatcctattcctggatgggtaaaccgacttgctcgtg |
4093678 |
T |
|
| Q |
454 |
taggtgagaatcgttctcataactagttcttgttgcataagtcataattt |
503 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4093677 |
taggtgagaatcgttctgataactagttcttgttgcataagtcataattt |
4093628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 8 - 53
Target Start/End: Complemental strand, 4094250 - 4094205
Alignment:
| Q |
8 |
tttatctctttggctttggaatctttcattccggtattgaaggttt |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094250 |
tttatctctttggctttggaatctttcattccggtattgaaggttt |
4094205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 4094181 - 4094147
Alignment:
| Q |
75 |
gcttgttatcatattcatatactaactagttgttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094181 |
gcttgttatcatattcatatactaactagttgttt |
4094147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 86; Significance: 7e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 163 - 463
Target Start/End: Original strand, 41432788 - 41433086
Alignment:
| Q |
163 |
acagtacatggtatggaatatgcctttggagcacatgaatacccaactagtggtgtgtttgaggtggaacctaaaaattgccctggctttgtcttcagac |
262 |
Q |
| |
|
||||| ||||| |||||||||| |||||||||||||| ||| || | ||||| || |||||||||||||||| || ||| || |||||| ||||||||| |
|
|
| T |
41432788 |
acagtgcatggcatggaatatgggtttggagcacatgagtactcatcaagtggagtatttgaggtggaacctagaagttgtccgggctttatcttcagac |
41432887 |
T |
|
| Q |
263 |
gatcggtattgttaggcagcactgatatgtctctcacagaattccgctgtcttttatggaccgtatctctgcaaaatatcatggagacacttaccatcta |
362 |
Q |
| |
|
|||| |||||||||||| || ||||||||| || |||| || | |||| || || || | || ||||||||||| ||||||||||||||||| |
|
|
| T |
41432888 |
gatcattattgttaggcacaacggatatgtcttattcacaatttcgtt--ctttcattgagcgcgtttcagcaaaatatcacggagacacttaccatctg |
41432985 |
T |
|
| Q |
363 |
attgccaaaaattgcaaccattttacgaatgaagtttgccaacaactaacaggaaatcctattcctggatgggtaaaccgacttgctcgtgtaggtgaga |
462 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||| |||||||||| ||||| |||| |||||||| || | |||||||| ||||||| |
|
|
| T |
41432986 |
attgctaagaattgcaaccattttacagatgaagtttgccaacagttaacaggaaagcctatccctgcgtgggtaaatcggttggctcgtgtcggtgaga |
41433085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University