View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4801_low_6 (Length: 256)
Name: NF4801_low_6
Description: NF4801
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4801_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 3219959 - 3219712
Alignment:
| Q |
1 |
taattttgttgcagaaagggccgctggaaagccgcaaggtgaggatggcagtctggaagttgtagaaagtccccctggaaaggttgcagaaagagccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219959 |
taattttgttgcagaaagggccgctggaaagccgcaaggtgaggatggcagtctggaagttgtagaaagtccccctggaaaggttgcagaaagagccatt |
3219860 |
T |
|
| Q |
101 |
ggaaagccgcaagtggggggaaatgatgatattgcaaaaagtttagaattttttacatgagctttactgcagcgctatctgaccactatcagtagtgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219859 |
ggaaagccgcaagtggggggaaatgatgatattgcaaaaagtttagaa--ttttacatgagctttactgcagcgctatctgaccactatcagtagtgcta |
3219762 |
T |
|
| Q |
201 |
ctctaaacttcaatgcaaaatggggtttcgtcgtgtcgcacccatgagcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219761 |
ctctaaacttcaatgcaaaatggggtttcgtcgtgtcgcacccatgagcc |
3219712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 49
Target Start/End: Original strand, 15985631 - 15985677
Alignment:
| Q |
3 |
attttgttgcagaaagggccgctggaaagccgcaaggtgaggatggc |
49 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15985631 |
attttgttgtagaaagggctgctggaaagccacaaggtgaggatggc |
15985677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 15985932 - 15985969
Alignment:
| Q |
191 |
agtagtgctactctaaacttcaatgcaaaatggggttt |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15985932 |
agtagcgctactctaaacttcaatgcaaaatggggttt |
15985969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 133
Target Start/End: Original strand, 15985684 - 15985738
Alignment:
| Q |
78 |
gaaaggttgcagaaagagccattggaaagccgcaagtggggggaaatgatgatatt |
133 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
15985684 |
gaaaggttgcagaaagggccaatggaaagccgcaag-agggggaaacgatgatatt |
15985738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University