View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4802_high_2 (Length: 375)
Name: NF4802_high_2
Description: NF4802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4802_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 6 - 359
Target Start/End: Original strand, 38512609 - 38512965
Alignment:
| Q |
6 |
cagagataatgtcctacagaaaaaacagata---tgcagcaaacaaaatcaaccaaccaatactttactactttctaaccatatttcactgtggttaggt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38512609 |
cagagataatgtcctacagaaaaaacagatagtatgcagcaaacaaaatcaaccaaccaatactttactacttcctaaccatatttcactgtggttaggt |
38512708 |
T |
 |
| Q |
103 |
gaagcattcaaacatccaacccatcatgtataaatgctgataaatccagcaggtactgcagcaagaacaatggccaaaatcaccgtcatcacgttgttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512709 |
gaagcattcaaacatccaacccatcatgtataaatgctgataaatccagcaggtactgcagcaagaacaatggccaaaatcaccgtcatcacgttgttga |
38512808 |
T |
 |
| Q |
203 |
tcatgacaggtctaaggttggatgaaccacctgtgcttgccggggtgggagttgtaggagttgcggtggttgcagcagctgatgaaggagtaggatttgc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512809 |
tcatgacaggtctaaggttggatgaaccacctgtgcttgccggggtgggagttgtaggagttgcggtggttgcagcagctgatgaaggagtaggatttgc |
38512908 |
T |
 |
| Q |
303 |
ctttgaagcatttttaaagattgcagcgtcgggggagtttgcagatagaccaagaag |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512909 |
ctttgaagcatttttaaagattgcagcgtcgggggagtttgcagatagaccaagaag |
38512965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University