View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4802_high_5 (Length: 204)
Name: NF4802_high_5
Description: NF4802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4802_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 37633587 - 37633536
Alignment:
| Q |
102 |
atttaattttaataatgtataaccttgtagcaattattaaattcattcacca |
153 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37633587 |
atttaattttaataatgtaaaaccttgtagcaattattaaattcattcacca |
37633536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 37809657 - 37809606
Alignment:
| Q |
102 |
atttaattttaataatgtataaccttgtagcaattattaaattcattcacca |
153 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37809657 |
atttaattttaataatgtaaaaccttgtagcaattattaaattcattcacca |
37809606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University