View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4803-Insertion-9 (Length: 81)
Name: NF4803-Insertion-9
Description: NF4803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4803-Insertion-9 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38440681 - 38440754
Alignment:
| Q |
8 |
gaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattgtt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38440681 |
gaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattgtt |
38440754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 38449069 - 38449141
Alignment:
| Q |
8 |
gaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattgtt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
38449069 |
gaggaagcatgtcaaactatgcctcttctagacactgtgcaa-gttgccatggttacttgttttcaagactgtt |
38449141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University