View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4804-Insertion-14 (Length: 197)
Name: NF4804-Insertion-14
Description: NF4804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4804-Insertion-14 |
 | |
|
| [»] scaffold0210 (1 HSPs) |
| |
|
| [»] chr3 (3 HSPs) |
| |
|
| [»] scaffold0479 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0210 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 197
Target Start/End: Complemental strand, 9391 - 9206
Alignment:
| Q |
10 |
attatcatcaacatcttttctcccttccctcattgaactcttgcaaatgcaatgttgcagactccggactaaatttttgagtactcttgcaaatgcaatg |
109 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9391 |
attatcatcaacacctt--ctcccttccctcattgaactcttgcaaatgcaatgttgcagactccagactaaatttatgagtactcttgcaaatgcaatg |
9294 |
T |
|
| Q |
110 |
tgtaaggagttttggatacaaaaactttagattcacatcctttttgcctcatcatgcaaaactgtctggcacatcctgtaatggacca |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9293 |
tgtaaggagttttgcatacaaaaactttagattcacattctttttgcctcgtcatgcaaaactgtctggcacatcctgtaatggacca |
9206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 12714943 - 12715129
Alignment:
| Q |
15 |
catcaacatcttttctcccttccctcattgaac-tcttg--ca-aatgcaatgttgcagactccggactaaatttttgagtactcttgcaaatgcaatgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||| || || | ||||||||| || ||||||||| |||||| ||||||||||||||| | |
|
|
| T |
12714943 |
catcaacatcttttctcccttccctcattgaacattttgatcagaaaatattgttgcagaagccaaactaaatttatgagtattcttgcaaatgcaattt |
12715042 |
T |
|
| Q |
111 |
gtaaggagttttggatacaaaaactttagattcacatcctttttgcctcatcatgcaaaactgtctggcacatcctgtaatggacca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12715043 |
gtaaggagttttggatacaaaaactttagatttgcatcctttttgcctcgtcatgcaaaactgtctggcacatcctgtaacggacca |
12715129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 9e-35
Query Start/End: Original strand, 87 - 197
Target Start/End: Original strand, 12722241 - 12722350
Alignment:
| Q |
87 |
tgagtactcttgcaaatgcaatgtgtaaggagttttggatacaaaaactttagattcacatcctttttgcctcatcatgcaaaactgtctggcacatcct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| ||||||| ||| |||||| || |
|
|
| T |
12722241 |
tgagtactcttgcaaatgcaatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatacaaaactctct-gcacattct |
12722339 |
T |
|
| Q |
187 |
gtaatggacca |
197 |
Q |
| |
|
||||||||||| |
|
|
| T |
12722340 |
gtaatggacca |
12722350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 62 - 197
Target Start/End: Original strand, 12709911 - 12710048
Alignment:
| Q |
62 |
tgttgcagactccggactaaatttttgagtactcttgcaaatgcaatgtgtaag-gagttttggatacaaaaa-ctttagattcacatcctttttgcctc |
159 |
Q |
| |
|
||||||||| ||| |||| |||| |||||||| |||||||||||||||||||| |||||||||||| ||||| |||| || || |||||||||||||| |
|
|
| T |
12709911 |
tgttgcagattccatactagatttatgagtactattgcaaatgcaatgtgtaagagagttttggataaaaaaaactttggactcgcatcctttttgcctt |
12710010 |
T |
|
| Q |
160 |
atcatgcaaaactgtctggcacatcctgtaatggacca |
197 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12710011 |
gtcatgcaaaaatgcctggcacatcctgtaatggacca |
12710048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0479 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: scaffold0479
Description:
Target: scaffold0479; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 87 - 197
Target Start/End: Complemental strand, 11930 - 11821
Alignment:
| Q |
87 |
tgagtactcttgcaaatgcaatgtgtaaggagttttggatacaaaaactttagattcacatcctttttgcctcatcatgcaaaactgtctggcacatcct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
11930 |
tgagtactcttgcaaatgcaatgtgtaagaagttttggatacaaaaactttggattcacatcctttttgccttgtcatgcaaaactctct-gcacatcct |
11832 |
T |
|
| Q |
187 |
gtaatggacca |
197 |
Q |
| |
|
||||||||||| |
|
|
| T |
11831 |
gtaatggacca |
11821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 94 - 197
Target Start/End: Complemental strand, 19713724 - 19713614
Alignment:
| Q |
94 |
tcttgcaaatgcaatgtgtaaggagttttggatacaaaaactttagattcacatcctttttgcctcatcatgcaaaa-------ctgtctggcacatcct |
186 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||| |||||| |||||||| ||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
19713724 |
tcttgccaatgcaatgtgcaaggatttttggatacaataactttggattcacaacctttttgccttgtcatgcaaaagtgtctgccgtctggcacatcct |
19713625 |
T |
|
| Q |
187 |
gtaatggacca |
197 |
Q |
| |
|
||||||||||| |
|
|
| T |
19713624 |
gtaatggacca |
19713614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University