View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4805_high_9 (Length: 241)
Name: NF4805_high_9
Description: NF4805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4805_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 33077289 - 33077095
Alignment:
| Q |
1 |
tcatttggtcccaggtttgagcttttgtggaggtactagggagttagagttttctgttttgaaggtggtgtatttgcttttgtggttgtaattttagtgg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33077289 |
tcatttggtcccgggtttgagcttttgtggaggt-ctagggagttagagttttctgttttgaaggtggtgtatttgcttttgtggttgtaattttagtgg |
33077191 |
T |
 |
| Q |
101 |
aattttacaccctactaatgcagtggctctgcacctttttggttaagtttggctaacttataaccaccatgatatccctatttacagtaattcaaa |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33077190 |
aattttacaccctactagtgcagtggctctgcacctttttggttaagtttggctaacctgtaaccaccatgatatccttatttacagtaattcaaa |
33077095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 41500803 - 41500702
Alignment:
| Q |
1 |
tcatttggtcccaggtttgagcttttgtggaggtactagggagttagagttttctgttttgaaggtggtgtatttgcttttgtggttgtaattttagtgg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||| |
|
|
| T |
41500803 |
tcatttggtcccaggcttgagcttttgtggaggtactagggagttagagttttctgttttgaaggtggtgtatttgcttttctagctgtaattttagtgg |
41500704 |
T |
 |
| Q |
101 |
aa |
102 |
Q |
| |
|
|| |
|
|
| T |
41500703 |
aa |
41500702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 233
Target Start/End: Complemental strand, 33070344 - 33070303
Alignment:
| Q |
192 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33070344 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
33070303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 233
Target Start/End: Complemental strand, 33072147 - 33072106
Alignment:
| Q |
192 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33072147 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
33072106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 192 - 233
Target Start/End: Complemental strand, 33076741 - 33076700
Alignment:
| Q |
192 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33076741 |
tcaaatgtatttaacaattgagttgtaacagtttgatgatgt |
33076700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University