View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4805_low_8 (Length: 257)
Name: NF4805_low_8
Description: NF4805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4805_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 54276859 - 54276632
Alignment:
| Q |
13 |
catcatcacaatgagaaagaaagagataagaaga---gaaaacaagtttggttaccagagtagttatgaggaagagggagagtagttccttcgagcaacc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54276859 |
catcatcacaatgagaaagaaagagataagaagaagagaaaacaagtttggttaccagagtagttatgaggaagagggagagtagttccttcgagcaacc |
54276760 |
T |
|
| Q |
110 |
ttcctcgaaaatgcgattgctgtaatggtaaaccgtcttctccgacgacgccggtaggtttaggtttgaaatactgagagacttcagtgggaccatcgtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54276759 |
ttcctcgaaaatgcgattgctgtaatggtaaaccgtcttctccgacgacgccggtaggtttaggtttgaaatactgagagacttcggtgggaccatcgtg |
54276660 |
T |
|
| Q |
210 |
cttgatgcagcagggaagtagatgaaca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54276659 |
cttgatgcagcagggaagtagatgaaca |
54276632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University