View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806-Insertion-14 (Length: 94)
Name: NF4806-Insertion-14
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806-Insertion-14 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 1e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 7 - 94
Target Start/End: Original strand, 21128994 - 21129081
Alignment:
| Q |
7 |
agagaatatctcctatagttattgtttagatagcaacaaatcatatagttgacttatgacaatcaattgtcattcatagtcattacag |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
21128994 |
agagaatatctcctgtagttattgtttagatagcaacaaatcatatagttgactcatgacaatcaattgtcattcttagtcattacag |
21129081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 7 - 94
Target Start/End: Original strand, 21134902 - 21134989
Alignment:
| Q |
7 |
agagaatatctcctatagttattgtttagatagcaacaaatcatatagttgacttatgacaatcaattgtcattcatagtcattacag |
94 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
21134902 |
agagaatatctcctgtagttattgtttagatagcaacaaatcatatagttgactcatgacaatcaattgtcattcttagtcattacag |
21134989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 76; Significance: 1e-35; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 6 - 93
Target Start/End: Original strand, 36599005 - 36599092
Alignment:
| Q |
6 |
cagagaatatctcctatagttattgtttagatagcaacaaatcatatagttgacttatgacaatcaattgtcattcatagtcattaca |
93 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36599005 |
cagaaaatatctcctatagttattgtttagatagcaacaaattatagagttgacttatgacaatcaattgtcattcatagtcattaca |
36599092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 4e-35
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 9039935 - 9039849
Alignment:
| Q |
8 |
gagaatatctcctatagttattgtttagatagcaacaaatcatatagttgacttatgacaatcaattgtcattcatagtcattacag |
94 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
9039935 |
gagaatatctcctgtagttattgtttagatagcaacaaatcatatagttgactcatgacaatcaattgtcattcttagtcattacag |
9039849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 9035487 - 9035400
Alignment:
| Q |
7 |
agagaatatctcctatagttattgtttagatagcaacaaatcatatagttgacttatgacaatcaattgtcattcatagtcattacag |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
9035487 |
agagaatatctcctgtagttattgtttagatagcaacaaattatatagttgactcatgacaatcaattgtcattcttagtcattacag |
9035400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University