View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806-Insertion-8 (Length: 249)
Name: NF4806-Insertion-8
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806-Insertion-8 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 8583872 - 8584113
Alignment:
| Q |
9 |
gatttgtgatcctttatctatctatattagtgtgtgtcactcacagttt-gatactctttttcttcttcttgttggtttgaaggttgaagtgtttgttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8583872 |
gatttgtgatcctttatctatctatattagtgtgtgtcactcactgttttgatactctttttcttcttcttgttggtttgaaggttgaagtgtttgttgt |
8583971 |
T |
|
| Q |
108 |
tggaggaatttgctctcaaaaagaagaggaacagtagatttatgtcttctcagtttattctggaatcagttattggggctctgttgaagaacctctggat |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8583972 |
tggaggaatttgctctaaaaaagaagaggaacagtagatttatgtcttctcagtttattctggaatcagttattggggctctgttgaagaacctctggat |
8584071 |
T |
|
| Q |
208 |
tttctctgtttcttatcttctgctcactctttctgtgttctg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8584072 |
tttctctgtttcttatcttctgctcactctttctgtgttctg |
8584113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 112 - 248
Target Start/End: Original strand, 8600608 - 8600744
Alignment:
| Q |
112 |
ggaatttgctctcaaaaagaagaggaacagtagatttatgtcttctcagtttattctggaatcagttattggggctctgttgaagaacctctggattttc |
211 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||||||| ||| || |||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
8600608 |
ggaatttgctcttaaaaacaagaggaatagtagatttatgtcttctcagtctatacttgaatcactgattgaggctctgttgaagaacctctggattttc |
8600707 |
T |
|
| Q |
212 |
tctgtttcttatcttctgctcactctttctgtgttct |
248 |
Q |
| |
|
||| |||||| ||||||||| ||| |||||||||||| |
|
|
| T |
8600708 |
tctatttcttctcttctgcttactttttctgtgttct |
8600744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 111 - 214
Target Start/End: Original strand, 47424008 - 47424111
Alignment:
| Q |
111 |
aggaatttgctctcaaaaagaagaggaacagtagatttatgtcttctcagtttattctggaatcagttattggggctctgttgaagaacctctggatttt |
210 |
Q |
| |
|
||||||||| ||| ||||||||| ||||| | |||||||||||||| ||||||| || ||||| | ||||||| || ||||| ||||||||||| ||| |
|
|
| T |
47424008 |
aggaatttggtctttaaaagaagacgaacaatgaatttatgtcttctcggtttattttgaaatcattgattggggttccgttgaggaacctctggacttt |
47424107 |
T |
|
| Q |
211 |
ctct |
214 |
Q |
| |
|
|||| |
|
|
| T |
47424108 |
ctct |
47424111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University