View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_high_27 (Length: 273)
Name: NF4806_high_27
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 37715148 - 37714944
Alignment:
| Q |
19 |
gattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaagatagattggtgacacctttgagcttgttccccttgagaggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37715148 |
gattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaagatagattggtgacacctttgagcttgttccccttgagaggg |
37715049 |
T |
|
| Q |
119 |
acttttcatccccttctacttcatgctaagggtcttgcttgtcccccctaatctatgtatcattcaccatttaattaaaattaattactcccctatgtac |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37715048 |
acttctcatccccttctacttcatgctaagggtcttacttgtcccccctaatctatgtatcattcaccatttaactaaaattaattactcccctatgtac |
37714949 |
T |
|
| Q |
219 |
cctaa |
223 |
Q |
| |
|
||||| |
|
|
| T |
37714948 |
cctaa |
37714944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 37708801 - 37708692
Alignment:
| Q |
19 |
gattatttgttatggcccatggttgcaaggatgggacatgttccattgtccatattaagatagattggtgacacctttgagcttgttccccttgagaggg |
118 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
37708801 |
gattatttgttatggcccatgattgcaaaattgggacatcttccattgtccatattaagatagattagtgacacttttgagcttgttccctttgagaggg |
37708702 |
T |
|
| Q |
119 |
acttttcatc |
128 |
Q |
| |
|
|||| ||||| |
|
|
| T |
37708701 |
acttctcatc |
37708692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University