View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_high_29 (Length: 268)
Name: NF4806_high_29
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 44546513 - 44546253
Alignment:
| Q |
1 |
atgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagctgagattgtataatactggatggaccatctgtgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546513 |
atgtcgttcattttcttcttcattgctgttgctgtcgttgttttgttcctgaagatgaagcagctgagattgtataatactggatggaccatctgtgatc |
44546414 |
T |
 |
| Q |
101 |
tttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaa---gaaggttgtagagctttttcttttgagtattagggtacctaatcttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44546413 |
tttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaagaagaaggtcgtagagctttttcttttgagtattagggtccctaatcttgt |
44546314 |
T |
 |
| Q |
198 |
gaagaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcttctc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546313 |
---gaagaaggaaatcatataaatctttttcatgatcccatgttctctttctagggttcttctc |
44546253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University