View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_high_34 (Length: 244)
Name: NF4806_high_34
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 52731084 - 52731298
Alignment:
| Q |
14 |
actaggactaacttttccaagaagtaggcaaaaggaaggaggagaagaaaagcaataatattgcggtaaactgggaaaacaagtttgctaacacccatgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52731084 |
actaggactaacttttccaagaagtaggcaaaaggaaggaggagaagaaaagcaataatattgcggtaaactgggaaaacaagtttgctaacacccatgt |
52731183 |
T |
|
| Q |
114 |
taagggcagctcttgagacgacatggaaaccagcatatccaaactgcagggccaacatggccgcatgcagctgaaaccgttctggtatggagcaccacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52731184 |
taagggcagctcttgagacgacatggaaaccagcatatccaaactgcagggccaacatggccgcatgcagctgaaaccgttctggtatggagcaccacat |
52731283 |
T |
|
| Q |
214 |
tctccccgaagatcc |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52731284 |
tctccccgaagatcc |
52731298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 21 - 189
Target Start/End: Original strand, 7370192 - 7370360
Alignment:
| Q |
21 |
ctaacttttccaagaagtaggcaaaaggaaggaggagaagaaaagcaataatattgcggtaaactgggaaaacaagtttgctaacacccatgttaagggc |
120 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||| |||||||| || || | || || |||||||||||||||||||| ||||||||||| || |
|
|
| T |
7370192 |
ctaacttttccaagaaataagcaaatggaaggaggagaagcaaagcaatgatgtttctatagacagggaaaacaagtttgctaactcccatgttaagtgc |
7370291 |
T |
|
| Q |
121 |
agctcttgagacgacatggaaaccagcatatccaaactgcagggccaacatggccgcatgcagctgaaa |
189 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
7370292 |
agctcttgaaacaacatggaaaccagcataaccaaactgcaaggccaacatggccacatgcagctgaaa |
7370360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University