View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_high_36 (Length: 240)
Name: NF4806_high_36
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 41614142 - 41613931
Alignment:
| Q |
11 |
aatgacatacccatttatttatgtttttctaattctatattcaaggactattatgacaatgttccacacattgaacaactgaaataactatttactcaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41614142 |
aatgacatacccatttatttatgtttttctaattctatattcaaggactattatgacaatgttccacacattgaacaactgaaataactatttactcaaa |
41614043 |
T |
 |
| Q |
111 |
ttttaatgtaacttgtttgtagaccnnnnnnnntacctgtagaacaacggtgcctgacagaacaaggattgaaactaagagatagaggcaaccaattatc |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41614042 |
ttttaatgtaacttgtttgtagaccaaaaaaaatacctgtagaacaacggtgcctgacagaacaaggattgaaactaagagatagaggcaaccaattatc |
41613943 |
T |
 |
| Q |
211 |
ttgtttctgtca |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41613942 |
ttgtttctgtca |
41613931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University