View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_high_38 (Length: 233)
Name: NF4806_high_38
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_high_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 45870260 - 45870044
Alignment:
| Q |
1 |
gcagattgtaaacttgcagaagtaattttattcagaagaaaaagggcaatcctcatacaaaaataaaataagaaaatcgcatattgatagagtgtaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45870260 |
gcagattgtaaacttgcagaagtaattttattcagaagaaaaagggcaatcctcatacaaaaataaaataagaaaatcgcatattgatagagtgaaacta |
45870161 |
T |
|
| Q |
101 |
aaaagatccagaatcaaaagttgaatctttttagactcaaatcacatatacacataggtagcctccccaactgattagatcatatgaaaattctatcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45870160 |
aaaagatccagaatcaaaagttgaatctttttagactcaaatcacatatacacataggtaacctccccaactgattagatcatatgaaaattctatcaga |
45870061 |
T |
|
| Q |
201 |
ttcattcagatcattat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45870060 |
ttcattcagatcattat |
45870044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University