View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4806_high_41 (Length: 216)

Name: NF4806_high_41
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4806_high_41
NF4806_high_41
[»] chr1 (1 HSPs)
chr1 (56-209)||(24042205-24042358)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 56 - 209
Target Start/End: Original strand, 24042205 - 24042358
Alignment:
56 gggcgagggtgatgcagataaacctaagaaaccaacacatgtgaaaagattatcaagtattggacttcaggtagaatctgtattgggaaggaaaactgaa 155  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24042205 gggcgagggtgatgcggataaacctaagaaaccaacacatgtgaaaagattatcaagtattggacttcaggtagaatctgtattgggaaggaaaactgaa 24042304  T
156 aacataaaagatttttacagtttggggagaaaattaggtcaagggcaatttggg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24042305 aacataaaagatttttacagtttggggagaaaattaggtcaagggcaatttggg 24042358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University