View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_low_40 (Length: 217)
Name: NF4806_low_40
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 37 - 202
Target Start/End: Complemental strand, 34071476 - 34071311
Alignment:
| Q |
37 |
agttgggcttagtaaattgaaaattgatgtttctacttcagaaaatgttatgacacacccgaaaattataattttacccccaactacaaccaaaaatcgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34071476 |
agttgggcttagtaaattgaaaattgatgtttctacttcagaaaatgttatgacacacccgaaaattataattttacccccaactacaaccaaaaatcgt |
34071377 |
T |
|
| Q |
137 |
agcgaattgaattaaactgtcgttggatcaactgtagttaactgcagttggctcagctgcacttaa |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34071376 |
agcgaattgaattaaattgtcgttggatcaactgtagttaactgcagttggctcagctgcacttaa |
34071311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University