View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4806_low_41 (Length: 216)
Name: NF4806_low_41
Description: NF4806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4806_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 56 - 209
Target Start/End: Original strand, 24042205 - 24042358
Alignment:
| Q |
56 |
gggcgagggtgatgcagataaacctaagaaaccaacacatgtgaaaagattatcaagtattggacttcaggtagaatctgtattgggaaggaaaactgaa |
155 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042205 |
gggcgagggtgatgcggataaacctaagaaaccaacacatgtgaaaagattatcaagtattggacttcaggtagaatctgtattgggaaggaaaactgaa |
24042304 |
T |
 |
| Q |
156 |
aacataaaagatttttacagtttggggagaaaattaggtcaagggcaatttggg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042305 |
aacataaaagatttttacagtttggggagaaaattaggtcaagggcaatttggg |
24042358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University