View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4807-Insertion-6 (Length: 130)
Name: NF4807-Insertion-6
Description: NF4807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4807-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 6e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 6e-38
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 26213174 - 26213253
Alignment:
| Q |
10 |
gatgattatgtactcctgattattttcatgttttactgcaccatgttggttcaaattgctacaaatgaacccattctata |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26213174 |
gatgattatgtactcctgattattttcatgttttactgcaccatgttggttcaaattgctacaaatgaacccattctata |
26213253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University