View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4808_high_17 (Length: 311)
Name: NF4808_high_17
Description: NF4808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4808_high_17 |
 | |
|
| [»] scaffold0010 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 8 - 161
Target Start/End: Complemental strand, 2235540 - 2235387
Alignment:
| Q |
8 |
caccacagaccaagtttatgcaggttttatatccattctgagggtgtatagataaggtattattgttacctgttagtctttgagccacctcttgtatttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2235540 |
caccacagaccaagtttatgcaggttttatatccattctgagggtgtatagataaggtattattgttacctgttagtctttgagccacctcttgtatttc |
2235441 |
T |
|
| Q |
108 |
acaactatcatgacataaatattgtctgttaaattgttcaagaacttaaaataa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2235440 |
acaactatcatgacataaatattgtctgttaaattgttcaagaacttaaaataa |
2235387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 293
Target Start/End: Complemental strand, 243991 - 243954
Alignment:
| Q |
256 |
atggcttctctccatcaactctccttgagtgatgaaga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
243991 |
atggcttctctccatcaactctccttgagtaatgaaga |
243954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 256 - 293
Target Start/End: Complemental strand, 249562 - 249525
Alignment:
| Q |
256 |
atggcttctctccatcaactctccttgagtgatgaaga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
249562 |
atggcttctctccatcaactctccttgagtaatgaaga |
249525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University