View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-10 (Length: 292)
Name: NF4809-Insertion-10
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 6 - 292
Target Start/End: Original strand, 50525889 - 50526174
Alignment:
| Q |
6 |
caagtcaacattctaattaacaccccacagggattcaatgtctttggtgaccccatcatatgttagtgagttattggagagaggcttcactttaaacact |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50525889 |
caagtcaacattctaattaacaccccacagg-attcaatgtctttggtgaccccatcatatgttagtgagttattggagagaggcttcactttaaacact |
50525987 |
T |
 |
| Q |
106 |
gttggaaacagactcttctattcagcacttccattgttgttgtggatctttggccctgttttggtcttcctttgttctctcaccatggttcctttgcttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50525988 |
gttggaaacagactcttctattcagcacttccattgttgttgtggatctttggccctgttttggtcttcctttgttctctcactatggttcctttgcttt |
50526087 |
T |
 |
| Q |
206 |
ataaccttgactttgtcatcactaagggaaagatggacccaaatcagaacacggattttgtttgagtttatacttttatgtctgttt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50526088 |
ataaccttgactttgtcatcactaagggaaagatggacccaaatcagaacacggattttgtttgagtttatacttttatgtctgttt |
50526174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University