View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4809-Insertion-12 (Length: 209)

Name: NF4809-Insertion-12
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4809-Insertion-12
NF4809-Insertion-12
[»] chr7 (2 HSPs)
chr7 (87-177)||(48966374-48966463)
chr7 (176-209)||(48966496-48966529)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 87 - 177
Target Start/End: Original strand, 48966374 - 48966463
Alignment:
87 gtgatatgttagatgaatgacctttaccaaaattttcatgctaatcaatctatcaaatcatcatcttactatgatattgaggttatattct 177  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||    
48966374 gtgatatattagatgaatgacctttaccaaaattttcatgctaatcaatcaatc-tatcatcatcttactatgatattgaggttatattct 48966463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 176 - 209
Target Start/End: Original strand, 48966496 - 48966529
Alignment:
176 ctcctaaagtaacgtgctcattctttaattatta 209  Q
    ||||||||||||||||||||||||||||||||||    
48966496 ctcctaaagtaacgtgctcattctttaattatta 48966529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University