View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-13 (Length: 223)
Name: NF4809-Insertion-13
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 1723157 - 1723379
Alignment:
| Q |
9 |
ggtttaacagatatgattataataaacgagtatttaagtacttgttactttattaatgctatgctactgctcctt--------------caagggtacta |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1723157 |
ggtttaacaaatatgattataataaacgagtatttaagtacttattactttattaatgctatgctactgctcctttaagtgttgcttgccaagggtacta |
1723256 |
T |
|
| Q |
95 |
gaggcaccatttttaagctttggacgttaattaattgattggcaattggagatgcattaggtaaaggtgattctccttctcccaacaaagtctttgaaaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1723257 |
gaggcaccatttttaagctttggacgttaattaattgattggcaattggagatgcattaggtaaaggtga------ttctcccaacaaagtctttgaaaa |
1723350 |
T |
|
| Q |
195 |
accataatctttctcttatatatgtttgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1723351 |
accataatctttctcttatatatgtttgt |
1723379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University