View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-14 (Length: 125)
Name: NF4809-Insertion-14
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 34388177 - 34388294
Alignment:
| Q |
8 |
gccaccaacagtattggcggaatgtgttgattgttcgacatcttccagaaagccgctgtcacaatcgggacatattggcatccctagcctccatacccta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34388177 |
gccaccaacagtattggcggaatgtgttgattgttcgacatcttccagaaagccgctgtcacaatcgggacatattggcatccctagcctccatacccta |
34388276 |
T |
|
| Q |
108 |
acaaatttgttgcaccta |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34388277 |
acaaatttgttgcaccta |
34388294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University