View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-15 (Length: 87)
Name: NF4809-Insertion-15
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 39; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 979677 - 979623
Alignment:
| Q |
34 |
agtaaattatagtgttgggtttgtcttc-tttttctttcagagaa-attttccct |
86 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
979677 |
agtaaattatagtgttgggtttgtcttcatttttctttcagagaacattttccct |
979623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University