View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-16 (Length: 210)
Name: NF4809-Insertion-16
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-16 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 65 - 210
Target Start/End: Original strand, 9278875 - 9279020
Alignment:
| Q |
65 |
caacttcatggttttctcacaaaccaaaacaaccaacatgttgatgatgaagatttttgtctctatcaatcaaaccatgaacgtttctgaattcttcaac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9278875 |
caacttcatggttttctcacaaaccaaaacaaccaacatgttgatgatgaagatttttgtctctatcaatcaaaccacgaacgtttctgaattcttcaac |
9278974 |
T |
 |
| Q |
165 |
atgacaaggaatagtaatggttcctttttgatcaaatccatattct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278975 |
atgacaaggaatagtaatggttcctttttgatcaaatccatattct |
9279020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 9278818 - 9278855
Alignment:
| Q |
8 |
ttaagactcaaaagaagataatttttcatgtaaattta |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9278818 |
ttaagactcaaaagaagataatttttcatgtaaattta |
9278855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University