View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809-Insertion-22 (Length: 461)
Name: NF4809-Insertion-22
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809-Insertion-22 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 146 - 461
Target Start/End: Original strand, 7887537 - 7887849
Alignment:
| Q |
146 |
tgtgtataaagcaatacatcctcatgtaaccagaaaaaatcaatgtatcctccaaatagggatataccaatgattgtggtcagtgtcaggtcactgtcaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887537 |
tgtgtataaagcaatacatcctcatgtaaccagaaaaaatcaatgtatcctccaaatagggatataccaatgattgtggtcagtgtcaggtcactgtcaa |
7887636 |
T |
|
| Q |
246 |
cggtccatgcaacttgcaaaatatcttgatcacgcaatcatattatataatgtcttgatcactnnnnnnnnnnnnnnnnnnntatggagcttccattcca |
345 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7887637 |
cggtccaagcaacttgcaaaat---ttgatcactcaatcatattatataatgtcttgatcactcacacaaacacacacaacatatggagcttccattcca |
7887733 |
T |
|
| Q |
346 |
acttcttcttcatgccctctttgtactaagctttatcttctccattttcatgggatcatgtggttttgtgtccttagaaaataatttaagttcatcccca |
445 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7887734 |
acttcttcttcatgtcctctttgtactaagctttatcttctccattttcatgggatcatgtggttttgtgtccttagaaaataatttaagttcatcccta |
7887833 |
T |
|
| Q |
446 |
tttccacgtaacttcc |
461 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7887834 |
tttccacgtaacttcc |
7887849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 8 - 71
Target Start/End: Original strand, 7887399 - 7887462
Alignment:
| Q |
8 |
gtaattagtttccccttttatctatttaattacttgggttcaaatataagtttaaggttgtaac |
71 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887399 |
gtaattagtttccccttttatccatttaattacttgggttcaaatataagtttaaggttgtaac |
7887462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University