View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809_high_9 (Length: 231)
Name: NF4809_high_9
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809_high_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 8085935 - 8085711
Alignment:
| Q |
7 |
aatgagataatcgttgttggacacatggttgtttctttgggttttcttgcattacactactttttattttaatatattcaatatggtactgcaattaata |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8085935 |
aatgagataatcgttgttgtacacatggttgtttctttgggttttcttgcattacactactttttattttaatatattcaatatggtactgcaattaata |
8085836 |
T |
 |
| Q |
107 |
tatcgtaggtgatagttttatcaataaaaaacatcataatcttatattgaaaccatgaccaagttaataatcagacagtgatcttctaaacctggtaaat |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8085835 |
tatagtaggtgatagttttatcaataaaaaacatcataatcttatattgaaaccatgaccaagttaataatcattcagtgatcttctaaaccgtgtaaat |
8085736 |
T |
 |
| Q |
207 |
gaacgttctttttatattggatata |
231 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
8085735 |
gaacgttctttttatatttgatata |
8085711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University