View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809_low_3 (Length: 298)
Name: NF4809_low_3
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 43567883 - 43567619
Alignment:
| Q |
1 |
aataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgcacttcacaggcatggtgagaaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43567883 |
aataaagttagcagggtacatgggaaatactagtgaggcattgtttgacatagatgaggaggaaaaagaagatgcacttcacaggcatagtgagaaactg |
43567784 |
T |
|
| Q |
101 |
gccatttcctatggaattatgaagattcaagctcctgggcctattcggattgtgaaaaacttgcgtgtctgtgaagattgtcacacagctaccaagttta |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43567783 |
gccattgcctatggaattatgaagattcaagctcctgggactattcggattgtgaaaaacttgcgtgtctgtgaagattgtcacacagctaccaagttta |
43567684 |
T |
|
| Q |
201 |
cctagaaggtttttgatgtagagttaattgtgagagatagaaacagatttcatcattttaaaaag |
265 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43567683 |
tctcgaaggtttttgatgtagagttaattgtgagagatagaaacagatttcatcattttaaaaag |
43567619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 200
Target Start/End: Original strand, 2447183 - 2447236
Alignment:
| Q |
147 |
ggattgtgaaaaacttgcgtgtctgtgaagattgtcacacagctaccaagttta |
200 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| | ||||| ||||||| |
|
|
| T |
2447183 |
ggattgtgaagaacttgcgtgtctgcgaagattgtcattctgctactaagttta |
2447236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University