View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809_low_4 (Length: 266)
Name: NF4809_low_4
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 35200251 - 35200002
Alignment:
| Q |
13 |
tgagatcagtcaccatcggtcatgatttgagtgtactattttcatgtgagtgaaaattaatttaactcgaccaatcaatggttaccataacatatgatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35200251 |
tgagatcagtcaccatcggtcatgatttgagtgtactattttcatgtgagtgaaaattaatttaactcgaccaatcaatggttaccataacatatgatct |
35200152 |
T |
|
| Q |
113 |
gagaaatgtcattgttagacttttgactaatttcttc------------aataattatcatatagaattacaatcagtacaaaatgacacaaatacacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35200151 |
gagaaatgtcattgttagacttttgactaattgcttcaatttaggtttgaataattttcatatagaattacaatcagtacaaaatgacacaaatgcacca |
35200052 |
T |
|
| Q |
201 |
tcgaatccaagtgggtggttgaaccggaggaaaacatcaagtgttttatg |
250 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35200051 |
tcgaatccaaacgggtggttgaaacggaggaaaacatcaagtgttttatg |
35200002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University