View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4809_low_6 (Length: 249)
Name: NF4809_low_6
Description: NF4809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4809_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 37453958 - 37453717
Alignment:
| Q |
1 |
taacccattgctaatatgaatataggaataaaccgtaaagcatttggttatgcttgcatatcacgaatgtctacaaggtgaacagtcctagatttgatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37453958 |
taacccattgctaatatgaatataggaataaaccgtaaagcatttggtcatgcttgcatatcacgaatgtctacaaggtgaacagtcctagatttgatat |
37453859 |
T |
|
| Q |
101 |
tgcctttgtagtttgatattaggnnnnnnnnnnnnnnnnntaattgggctttcttagtgttggtagatgctgcactgtggttagacactgttacaccgta |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37453858 |
tgcctttgtagtttgatattaggtctctctctctttctcttaattgggctttcttagtgttggtagatgctgcactgtggttagacactgttataccgta |
37453759 |
T |
|
| Q |
201 |
tacctagtatgtttgaataatgttgatatcttgaagtataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37453758 |
tacctagtatgtttgaataatgttgatatcttgaagtataat |
37453717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University